Association of Actinomyces Israelii with Pyogenic Granuloma - A RT-QPCR Study

Introduction

Actinomyces species are considered saprophytic endogenous flora of the oral cavity, which causes suppurative, granulomatous inflammatory lesions and are locally aggressive and destructive. The microbiological picture of Actinomyces species reveals that they are anaerobic, non-acid-fast, and microphilic with filamentous branching. They are normal habitants of the human body especially oral cavity but will turn aggressive once they penetrate submucosal tissues whenever there is a disruption in the mucosal barrier.^1,2,3 This genus may include almost 30 species, among which Actinomyces israelii are the most prevalent one. Normally, these organisms are not capable of penetrating the oral mucosa; however, when the mucosal barrier is disturbed by trauma or irritation, they will easily find their way toward the submucosa. ^4,5

Pyogenic granulomas are nonneoplastic inflammatory hyperplasia that responds to diverse stimuli viz chronic trauma, local irritation and hormonal changes. History of trauma is evident in about one-third of the lesion.⁶

Actinomyces species clinically reveal a very characteristic picture of sulfur granules and their diagnosis is routinely done by histopathological examination.⁶ But culturing Actinomyces species in artificial media is difficult. For bacterial species and strains that are considered challenging or even impossible to grow in artificial culture, polymerase chain reaction (PCR) and DNA sequencing may act as excellent alternatives. Therefore, based on two hints that pyogenic granuloma usually has a history of trauma and Actinomyces israelii, the normal commensal of the oral cavity is capable of invading deeper tissue whenever there is a break in the mucosal barrier. We aimed to study the association of Actinomyces israelii and pyogenic granuloma using polymerase chain reaction (PCR).

Materials and Methods

A total of 15 formalin-fixed paraffin-embedded (FFPE) and histopathologically confirmed pyogenic granuloma samples were taken. 11 samples are from the anterior region of the gingival (5 maxilla, 6 mandibles), 3 from the buccal mucosa, and 1 from the retromolar area. Serial paraffin sections of 10 μm thickness were taken from these formalin-fixed and paraffin-embedded tissue specimens.

Paraffin removal was done by transferring sections of each samples into a 2 ml centrifuge tube and placed in microwave oven at 60°C for 15 minutes and then xylene was added. Ethanol rehydration was done by the addition of grades of alcohol (100%,90%,50%,30%) and spinning in a centrifuge. Then phosphate buffer saline is added and incubated for 5 minutes at room temperature and subjected to centrifuge. The supernatant was removed. The tissue digestion was done by addition of 500ml of lysis buffer with 5ml of proteinase K. After vortexing the tube, incubation was done at 65°C overnight in a microwave oven. DNA was extracted using a DNA extraction kit (HiPer® Bacterial Genomic DNA Extraction-HiMedia) according to the manufacturer’s protocol.

The primer sequence for Actinomyces israelii used was FORWARD: AAGTCGAACGGGTCTGCCTTG REVERSE: TCAAAGCCTTGGCAGGCCATC. The working solution was prepared by adding forward and reverse primers along with nuclease-free water.

The final reaction volume of 10 μL containing 1 μL of the isolated DNA solution, 1 μL of working solution of the primer, 5 μL of master mix, and 3 μL nuclease-free water was added to the well plate with 96 well capacity. The well plate with the sample was loaded in the REAL TIME PCR machine (Figure 1) and set up to run the PCR.

Result

Out of 15 samples, 13 samples (86.7%) had expressed Actinomyces israelii (Table 1,2) (Figure 2,3) with mean CT value 33.2524 ± 2.1294 suggesting that Actinomyces israelii have a association with pyogenic granuloma. There was a weak negative correlation (r= - 0.022) between age and ct value and the correlation was found to be statistically insignificant (p=0.943) (Table 3,4). Among the 15 samples, 11 samples were from gingiva of anterior teeth, 3 from buccal mucosa and 1 retromolar area. Among these 11 out of 11 samples from gingiva (100%), 2 out of 3 samples from buccal mucosa (66.6%) had expressed Actinomyces israelii with mean CT value 33.1812+2.2765 and 33.64445+1.4910 respectively. 2 samples, one from buccal mucosa and other from the retromolar area were turned undetermined (Table 5).

Discussion

Pyogenic granulomas are common vascular proliferations that result from chronic low-grade irritation of the oral mucosa. Among the overall biopsies taken from the oral cavity, pyogenic granuloma biopsies alone account approximately 1.5–7.0%.^6,7 The most common site of pyogenic granulomas in the oral cavity is gingiva and other common sites includes tongue, lips and cheeks.⁹ Though the exact etiology is not clear, a possible proposed etiology includes stimuli such as chronic local irritation, trauma, and hormonal changes. It should be highlighted that infective organisms viz Bartonella henselaea (peliosis hepatis), human herpes virus type ⁸, B. henselae and B. quintana (bacillary angiomatosis), have been spotted in other vascular tumors and some authors have postulated that the infective agents may play a part in recurrent pyogenic granuloma. However, gingival trauma, food impaction, rough cavity restorations may also act as a precipitating factor especially in those patients⁸ with poor oral hygiene and consequent calculus accumulation.⁹ These localized overgrowths which are composed of mature collagen bundles and cellular fibroblastic tissues are usually not considered neoplasms. Rather they are considered as hyperplastic inflammatory reactions.² Moreover, the irritating agents may induce endothelial, vascular or fibroblast growth factors which might play vital role in angiogenesis and the development of pyogenic granulomas.⁸

However, the pathogenesis of pyogenic granulomas still remains unclear. Based on the previous data trauma was allude to be most common initiating factor. Approximately, incidence of one-third of the lesion was following an event of injury. So a history of trauma before the development of a lesion is not unusual in pyogenic granulomas.⁸ Apparently, this might explain the predominance of pyogenic granulomas in the gingival region when compared to other oral sites. It has often been highlighted that there is an infectious cause owing to the persistent presence of microorganisms.

Actinomyces spp., are normal habitants of human oral cavity, with the tendency to penetrate submucosal tissues whenever there is a disruption in mucosal barrier,^10,11 however, Actinomyces spp. are also spotted in healthy persons.¹¹ Encountering of Actinomyces spp. in the intraoral mucosal region are very rare when the mucosa is intact.^4,12 But when a break arises in the mucosa due to any trauma, then in such circumstances it will be easier for these organisms that enter tissues through an area are sometimes prior triggers. Although nonspecific organism in pyogenic granulomas are relatively common, there are very few reports that accounts for the association of pyogenic granuloma with Actinomyces spp.

Actinomyces spp. are usually identified by the demonstration of these organisms in histopathological specimens, as well as their culture. Previous reports have pointed out that it is challenging to culture Actinomyces spp.¹³

PCR can be used as an alternative technique for the identification of microorganisms that are difficult to culture.

In our study, to identify Actinomyces israelii we have used real-time PCR, which is highly sensitive and specific. In our study, 86% of the samples (13 out of 15) expressed Actinomyces israelii with a mean CT value of 33.2524 ± 2.12941 and two samples were undetermined. Among these samples, all the 11 out of 11 samples from gingiva of anterior teeth and 2 out of 3 samples from buccal mucosa have expressed Actinomyces israelii with good CT value. According to previous studies, the anterior teeth and their associated structures are the most common sites prone to trauma. In our study, 11 out of 15 samples were from gingiva of anterior teeth and all (11/11) of these samples have expressed Actinomyces israelii convince that trauma had broken the mucosal barrier through which the Actinomyces israelii would have entered and established its association with pyogenic granuloma. However, the actual role of Actinomyces israelii in pyogenic granuloma is unknown. Whether they help in initiation, progression, or recurrence is not clear. This is a pioneering study that attempted to study the existence of Actinomyces israelii within the pyogenic granuloma tissue and further studies with larger sample sizes are needed.

In the present study, we considered only Actinomyces israelii whereas; combined infection with other microorganisms could not be eliminated. Combined infection with organisms such as staphylococci and streptococci was also considered a possibility, and it remains a subject for investigation in the future. Some studies showed recurrence rates ranging from 3–23%.^9,14 So after complete excision, the lesion must be excised down to the underlying tissue, and predisposing factors must be removed to avoid recurrence.¹⁵

Conclusion

Many studies have been conducted to establish the definitive etiology of pyogenic granuloma; however, it remains unclear. With the development of molecular studies, the organisms that are challenging to culture can be extensively studied. Microorganism may play a possible role in recurrence. It was suggested that the identification of the causative microorganisms of the irritation would definitely serve as a tool for the radical treatment of pyogenic granulomas. Such studies should be encouraged in the future in contemplation of preventing the recurrence.

Conflict of Interest

Nil

Ackowledgement

Nil